View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_185 (Length: 291)
Name: NF9839A_low_185
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_185 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 7 - 148
Target Start/End: Original strand, 24978713 - 24978854
Alignment:
| Q |
7 |
tttcgtgttagacgatttgtacaatataaatggcttgcaactcgtggtgttgatgaagaaaccattctacgttcattgccaaccgatcttcgtcgtgata |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24978713 |
tttcgtgttagacgatttgtacaatataaatggcttgcaactcgtggtgttgatgaagaaaccattctacgttcattgccaaccgatcttcgtcgtgata |
24978812 |
T |
|
| Q |
107 |
tccagcgccacctatgcttagaccttgttagacgagtatgac |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24978813 |
tccagcgccacctatgcttagaccttgttagacgagtatgac |
24978854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 206 - 289
Target Start/End: Original strand, 24978912 - 24978995
Alignment:
| Q |
206 |
gaaaatcttatatcgtagtagttatgtttcacttgcatgtacttttatgtatagatcctttttatgtatagatcctccttagct |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24978912 |
gaaaatcttatatcgtagtagttatgtttcacttgcatgtacttttatgtatagatcctttttatgtatagatcctccttagct |
24978995 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 94 - 146
Target Start/End: Original strand, 50399303 - 50399355
Alignment:
| Q |
94 |
cttcgtcgtgatatccagcgccacctatgcttagaccttgttagacgagtatg |
146 |
Q |
| |
|
|||||| | |||||||| |||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
50399303 |
cttcgtagagatatccaacgccacctttgcttagaccttgttcgacgtgtatg |
50399355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University