View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_19 (Length: 449)
Name: NF9839A_low_19
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 403; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 403; E-Value: 0
Query Start/End: Original strand, 17 - 431
Target Start/End: Original strand, 31777791 - 31778205
Alignment:
| Q |
17 |
atcactgccctggcgccgttcagtttctttttaaagtgaatgaaactgtatcccctaggtatgttcatactggtgattttaggtttaatcgtgaaatgtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31777791 |
atcactgccctggcgccgttcagtttctttttaaagtgaatgaaactgaatcccctaggtatgttcatactggtgattttaggtttaatcgtgaaatgtt |
31777890 |
T |
 |
| Q |
117 |
gttggatttgaatcttggtgaatttattggtgcggatgctgtgtttttggatacgacttattgtcatcccaaatttgtttttccgactcaaaatgaatcg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31777891 |
gttggatttgaatcttggtgaatttattggtgcggatgctgtgtttttggatacgacttattgtcatcccaaatttgtttttccgactcaaaatgaatcg |
31777990 |
T |
 |
| Q |
217 |
gttgattatatcgttgatgtcgtaaaggaatgtgatggtgagaatgttttgtttcttgttgctgcttatgttgttggtaaggagaagattttgcttgaga |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31777991 |
gttgattatatcgttgatgtcgtaaaggaatgtgatggtgagaatgttttgtttcttgttgctacttatgttgttggtaaggagaagattttgcttgaga |
31778090 |
T |
 |
| Q |
317 |
ttgcacggaggtgtgggaagaaagtgtgtgtggatggaaaaaagatggaggttttgcgggctcttgggtatggtgagagtggtgagtttaccgaggatag |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31778091 |
ttgcacggaggtgtgggaagaaagtgtgtgtggatggaaaaaagatggaggttttgcgggctcttgggtatggtgagagtggtgagtttaccgaggatag |
31778190 |
T |
 |
| Q |
417 |
gttggagagtgatgt |
431 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
31778191 |
gttggagagtaatgt |
31778205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University