View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_191 (Length: 287)
Name: NF9839A_low_191
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_191 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 41 - 255
Target Start/End: Original strand, 47560648 - 47560862
Alignment:
| Q |
41 |
gtaaaattaaatgacccattttttaatagatgaagaacccatttttaatttacaaagatggtggtccttttacggataagcctaacacagccaaattcaa |
140 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
47560648 |
gtaaaattaaatgacccatttttcaatagatgaagaacccatttttaatttacaaagatggtggtccttttacggatatgcctaacacagtcaaattcaa |
47560747 |
T |
 |
| Q |
141 |
aaagctcaaagagaactcagatttactagaagaaggatattgttggagtgctgatgtaaacaaataatctactagttgtcggaagaagatgtgtttcagt |
240 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47560748 |
aaagctcaaagagaactcagatttgctagaagaaggatattgttggagtgctgatataaacaaataatctactagttgtcggaagaagatgtgtttcagt |
47560847 |
T |
 |
| Q |
241 |
gttgattttgaaaag |
255 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
47560848 |
gttgattttgaaaag |
47560862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University