View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_207 (Length: 279)
Name: NF9839A_low_207
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_207 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 275
Target Start/End: Complemental strand, 28551161 - 28550887
Alignment:
| Q |
1 |
gagtcatcgtaatctattgaaccgtatgaatatctcgtgtaagattatcacctgtgaaaagagatcatgtcttatgtgcaagaatgagtctacgaacgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28551161 |
gagtcatcgtaatctattgaaccgtatgaatatctcgtgtaagattatcacctgtgaaaagagatcatgtcttatgtgcaagaatgagtctacgaacgat |
28551062 |
T |
|
| Q |
101 |
ccaacaagacaaccatctgggatcttagaggaaattcgcaattggcgtgaagatgagatagagtctctagcacattaattcagttttattgaaatgtgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28551061 |
ccaacaagacaaccatctgggatcttagaggaaattcgcaattggcgtgaagatgagatagattctctagcacattaattcagttttattgaaatgtgtt |
28550962 |
T |
|
| Q |
201 |
taatatggcatgaaccttgtgatttttaaacatcaataatacttcactttcctttttgttgggacggtgcatgtg |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28550961 |
taatatggcatgaaccttgtgatttttaaacatcaataatacttcactttcctttttgttgggacggtgcatgtg |
28550887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University