View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_212 (Length: 277)
Name: NF9839A_low_212
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_212 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 277
Target Start/End: Original strand, 10551379 - 10551655
Alignment:
| Q |
1 |
aagactaactatgctatattgtcttccttgaggttaaaatgtgccggcatgttctttggttttgttttgagaaatttttctttatggaagtataacctaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
10551379 |
aagactaactatgctatattgtcttccttgaggttaaaatgtgccgacatgttctttggttttgtttttagaaagttttctttatggaagtataacctaa |
10551478 |
T |
 |
| Q |
101 |
cacgtaagggaccataggagctgttgtcactcaaccttcctaatttgattctactactaaaccatccatcacaacaaagccttttatccctccacacaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10551479 |
cacgtaagggaccataggagctgttgtcactcaaccttcctaatttgattctactactaaaccatccatcacaacaaagccttttatccctccacacaat |
10551578 |
T |
 |
| Q |
201 |
gtgttttgcatttttatgtttttagaggtggtggtattctaaatggtggttgtgggttgttgatgtatgtgaaatga |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10551579 |
gtgttttgcatttttatgtttttagaggtggtggtattctaaatggtggttgtgggttgttgatgtctgtgaaatga |
10551655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University