View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_235 (Length: 265)
Name: NF9839A_low_235
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_235 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 2 - 256
Target Start/End: Complemental strand, 32180323 - 32180069
Alignment:
| Q |
2 |
catattatggcattgtattacaccatttcaaaaaacacacatgatattaataaacgcacctgacttttctcccttctactatccctcagtttcttgtcaa |
101 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32180323 |
catattatggcattgtattacaccgtttcaaaaaacacacatgatattaataaacgcacctgacttttctcccttctactatccctcagtttcttgttaa |
32180224 |
T |
|
| Q |
102 |
gacaaacaatttcttccctcgttctcattttcttcatcaaacaagcaaaagaaggtatcatcacaagaaacatcgacggtaagagaaactcaaataagac |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32180223 |
gacaaacaatttcttccctcgttctcattttcttcatcaaacaagcaaaagaaggtatcatcacaagaaacattgacggtaagagaaactcaaataagac |
32180124 |
T |
|
| Q |
202 |
aatatgccactcagcacataacaagatgaaaagctgtcatttttcctccaacacc |
256 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32180123 |
aatatgtcactcagcacataacaagatgaaaagttgtcatttttcctccaacacc |
32180069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University