View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_240 (Length: 261)
Name: NF9839A_low_240
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_240 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 8 - 246
Target Start/End: Original strand, 43797899 - 43798137
Alignment:
| Q |
8 |
attcggaagttgtggtgaaaaatttaaagggatgtaatcctactagtgtagtgggttggtgcttaattaacaagattcttagtttgctttcgatggattg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43797899 |
attcggaagttgtggtgaaaaatttaaagggatgtaatcctactagtgtagtgggttggtgcttaattaacaagattcttagtttgcttgcgatggattg |
43797998 |
T |
|
| Q |
108 |
ggaggttagagtttgtgactagtattgtgcagctaattgatgtgtttatgctcttgttaatatggggtgcgatagcgaggacgcttgaatactttttgag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43797999 |
ggaggttagagtttgtgactagtattgtgcagctaattaatgtgtttatgctcttgttaatatggggtgcgatagcgaggacgcttgaatactttttgag |
43798098 |
T |
|
| Q |
208 |
ttatgtcttgttcaaactagttggttcgtcattattgat |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43798099 |
ttatgtcttgttcaaactagttggttcgtcattattgat |
43798137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University