View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_245 (Length: 259)
Name: NF9839A_low_245
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_245 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 6 - 243
Target Start/End: Original strand, 37676973 - 37677210
Alignment:
| Q |
6 |
gtttggtgttgatgttatgccgcctggacgaagaaaaggcgccaagaaatcaacggccacggctggttcttcccgttcccggtcccggtcccggcggcaa |
105 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
37676973 |
gtttcgtgttgatgttatgccgcctggacgaagaaaaggcgccaagaaatcaacggccacggctggttcttcccggtcccggtcccggtcccgccggcaa |
37677072 |
T |
 |
| Q |
106 |
tggaacatcggcgatctcgttcttgccaaggttaaaggcttccctgcttggcctgcaacggtatgtgnnnnnnnngtaatctttacttaagctttgaatt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
37677073 |
tggaacatcggcgatctcgttcttgccaaggttaaaggcttccctgcttggcctgcaacggtatgtgttttttttgtaatctttacttaagctttgaatt |
37677172 |
T |
 |
| Q |
206 |
tctttgttaattatgctgttgtgaattacactggatcg |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37677173 |
tctttgttaattatgctgttgtgaattacactggatcg |
37677210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 194 - 243
Target Start/End: Original strand, 37677448 - 37677497
Alignment:
| Q |
194 |
aagctttgaatttctttgttaattatgctgttgtgaattacactggatcg |
243 |
Q |
| |
|
|||||||| |||||||| ||||||||| |||| |||||||||||||||| |
|
|
| T |
37677448 |
aagctttggatttcttttttaattatgttgtttggaattacactggatcg |
37677497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 113 - 163
Target Start/End: Complemental strand, 13828423 - 13828373
Alignment:
| Q |
113 |
tcggcgatctcgttcttgccaaggttaaaggcttccctgcttggcctgcaa |
163 |
Q |
| |
|
|||||||||||||||| || ||||||||||| ||||| ||||||||||||| |
|
|
| T |
13828423 |
tcggcgatctcgttctcgctaaggttaaaggtttccccgcttggcctgcaa |
13828373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 115 - 168
Target Start/End: Complemental strand, 32236328 - 32236275
Alignment:
| Q |
115 |
ggcgatctcgttcttgccaaggttaaaggcttccctgcttggcctgcaacggta |
168 |
Q |
| |
|
|||||||| |||||||| || ||||||||||||||||| |||||||| |||||| |
|
|
| T |
32236328 |
ggcgatctagttcttgctaaagttaaaggcttccctgcatggcctgccacggta |
32236275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 115 - 161
Target Start/End: Complemental strand, 28645357 - 28645311
Alignment:
| Q |
115 |
ggcgatctcgttcttgccaaggttaaaggcttccctgcttggcctgc |
161 |
Q |
| |
|
|||||||| || ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
28645357 |
ggcgatcttgtccttgctaaggttaagggcttccctgcttggcctgc |
28645311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University