View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_264 (Length: 252)
Name: NF9839A_low_264
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_264 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 44735833 - 44736063
Alignment:
| Q |
1 |
aattacaaaataaaggagctcaaaagacaatcaagacccgataaaattacaggctgaggtcaatatgagttgaaaattgagatcattatgcaatataatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44735833 |
aattacaaaataaaggagctcaaaagacaatcaagacccaataaaattacaggctgaggtcaatatgagttgaaaattgagatcattatgcaatataatc |
44735932 |
T |
 |
| Q |
101 |
atgaagtaaattggtaatctttcaagaaaaatatctgctctctagaaccaacatttgaatgagaacaaaaggtatcaaacagccaacctctagtagcagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44735933 |
atgaagtaaattggtaatctttcaagaaaaatatctgctctctagaaccaacatttgaatgagaacaaaaggtatcaaacagccaacctctagtagcagc |
44736032 |
T |
 |
| Q |
201 |
ttgttcattgtctttccatcacaatttatga |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44736033 |
ttgttcattgtctttccatcacaatttatga |
44736063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University