View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_265 (Length: 252)
Name: NF9839A_low_265
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_265 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 33 - 241
Target Start/End: Complemental strand, 8884442 - 8884233
Alignment:
| Q |
33 |
aggggttttggtgtgactagagggagataagagtttggatcttgttttgatgaccattctcgatggagttgatgatttggcacaagtttggtttatattg |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
8884442 |
aggggttttggtgtgactagagggagataagagtttggatcttgttttgatgaccattctcgatggagttaatgatttggcacaagtttggtttatgttg |
8884343 |
T |
|
| Q |
133 |
ttgtgaggaggttaggttgtgtatttggtgttagtggttagnnnnnnngtattggtttttggtggcagccctaggtt-gagcggtgtctttatgagtgtt |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| | | |||||||||||||||||| |
|
|
| T |
8884342 |
ttgtgaggaggttaggttgtgtatttggtgttggtggttagtttttttgtattggtttttggtggcagccctaggttggggtggtgtctttatgagtgtt |
8884243 |
T |
|
| Q |
232 |
tttgatgtcc |
241 |
Q |
| |
|
|||| ||||| |
|
|
| T |
8884242 |
tttgttgtcc |
8884233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University