View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_278 (Length: 251)
Name: NF9839A_low_278
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_278 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 35 - 242
Target Start/End: Original strand, 2370199 - 2370397
Alignment:
| Q |
35 |
ggaagaataggaatgatggagtattaatcttttcagatgattggggagattgtgattgcgatggttgcgatgtttgtgactgtgactgtggaggttgtgt |
134 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2370199 |
ggaagaataggaataatggagtattaatcttttcagatgattggggagattgtgattgcgatggttg---------tgactgtgactgtggaggttgtgt |
2370289 |
T |
|
| Q |
135 |
agatgtgtgtagcgggatcgaatggagtggttgcttc-ggtgattgaatggagtgattgctcctttgtgatttctaagtctttcttatttcaactttatt |
233 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2370290 |
agatgtgtgtagcgggattgaatggagtggttgcttcaggtgattgaatggagtgatggctcctttgtgatttctaagtctttcttatttcaac-ttatt |
2370388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University