View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_298 (Length: 249)
Name: NF9839A_low_298
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_298 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 23378239 - 23378009
Alignment:
| Q |
1 |
atttagggttttaaggtgatttaagagtgaggactgaaaaaatgtgcatgaggatttggtgactcttatgggtgaacataattggattgtgagatgttt- |
99 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23378239 |
atttagggttttgaggtgatttaagagcgaggactgaaaaaatgtgcatgaggatttggtgactcttatgggtgaacataattggattgtgagatcaaac |
23378140 |
T |
|
| Q |
100 |
atgttcattgagaagtcaatcaatgtgcttaatgtcttgctactcttggttataatgaaagacttgattcgacaaaactctcatccccaaccttctttat |
199 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23378139 |
atattcattgagaagtcaatcaatgtgcttaatgtcttgttactcttggttataatgacagacttgattcgacaaaactctcatccccaaccttctttat |
23378040 |
T |
|
| Q |
200 |
tttttattacttcataatgattgtagaatgat |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
23378039 |
-ttttattacttcataatgattgtagaatgat |
23378009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University