View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_301 (Length: 249)
Name: NF9839A_low_301
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_301 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 83 - 249
Target Start/End: Original strand, 28524250 - 28524413
Alignment:
| Q |
83 |
gtgtctgacaccggtacaccttccaagttccgtcagaaatgtcggtgctacacatatatcaaatgtctagtagaaatggtggaaatacaaggttaatctt |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28524250 |
gtgtctgacaccggtacaccttccaagttccgtcagaaatgtcggtgctacacatatatcaaatgtctagtagaaatggtggaaatacatggttaatctt |
28524349 |
T |
 |
| Q |
183 |
aacaaaatcacacgtactattttattattttaaggaataaaattaactattgaaacatgggaaataa |
249 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28524350 |
aacaaaatcacacgtactatt---ttattttaaggaataaaagtaactattgaaacatgggaaataa |
28524413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 17 - 56
Target Start/End: Original strand, 28524182 - 28524221
Alignment:
| Q |
17 |
gacatcaacacgacgacactgatacaaccataagaatttg |
56 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
28524182 |
gacatcaacacgacggcactgatacaaccgtaagaatttg |
28524221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University