View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_306 (Length: 248)
Name: NF9839A_low_306
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_306 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 2 - 232
Target Start/End: Original strand, 32060223 - 32060453
Alignment:
| Q |
2 |
tgactcaacaatggtatcaaaactaatgatttgcgtatcaaaattcctcctaacaatagtagttagacgatatgtcacattgatgtatctctacttggaa |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
32060223 |
tgactcaacaatggtatcaaaactaatgatttgcgtatcaaaattcctcctaacaatagtagttagacgatgtgtcacattgatgtatgtctacttggaa |
32060322 |
T |
|
| Q |
102 |
taatgtttggaaatgggaggggctcaaagaataaaatgctttgtttggttgctttataatgatggattgaagactaaggatgtaagatctatatatgata |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32060323 |
taatgtttggaaatgggaggggctcaaagaataaaatgctttgtttggttgctttataatgatggattgaagactaaggatgtaagatctatatatgata |
32060422 |
T |
|
| Q |
202 |
tgggtacaaatttgttctgacctttgtgttc |
232 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |
|
|
| T |
32060423 |
tgggtacaaattcgttctgacctttgtgttc |
32060453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 90 - 174
Target Start/End: Original strand, 37258011 - 37258096
Alignment:
| Q |
90 |
ctctacttggaataatgtttggaaatgggaggggc-tcaaagaataaaatgctttgtttggttgctttataatgatggattgaaga |
174 |
Q |
| |
|
|||||| |||||||||||||| ||||| |||| || ||||| ||||||||||||| ||||| ||||||| ||| |||||||||||| |
|
|
| T |
37258011 |
ctctacctggaataatgtttgaaaatgagaggagcctcaaaaaataaaatgctttctttggctgctttacaattatggattgaaga |
37258096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University