View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_309 (Length: 248)
Name: NF9839A_low_309
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_309 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 22 - 231
Target Start/End: Original strand, 4366052 - 4366261
Alignment:
| Q |
22 |
ccctatagatgttttagggaagggattctatgttaccttaggctctcttaagaagagattgatgaaatttccaaattgactttgatctctacaattccaa |
121 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4366052 |
ccctatagatgttttaaggaagggattctatgttaccttaggctctcttaagaagagattgatgaaatttccaaattgactttgatctctacaattccaa |
4366151 |
T |
|
| Q |
122 |
gcttccattctcgtgacttctcttcatctctaattacttcttctccttctaagttgctgcccacatagggagaattaaggggtttgaattttgattcttc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4366152 |
gcttccattctcgtgacttctcttcatctctaattacttcttctccttctaagttgctgcccacatagggagaattaaggggtttgaattttgattcttc |
4366251 |
T |
|
| Q |
222 |
tcaattgatg |
231 |
Q |
| |
|
|| ||||||| |
|
|
| T |
4366252 |
tctattgatg |
4366261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University