View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_310 (Length: 248)
Name: NF9839A_low_310
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_310 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 248
Target Start/End: Complemental strand, 42365850 - 42365621
Alignment:
| Q |
19 |
catcattaatacgttatgtataacgtcctttgtaataaatagcactatgcgataaagtattcttgtcgtatgttgcctgctaacactagtttactggaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42365850 |
catcattaatacgttatgtataacgtcctttgtaataaatagcactatgcgataaaatattcttgtcgtatgttgcctgctaacactagtttactggaat |
42365751 |
T |
|
| Q |
119 |
tcactttatttgatgattgtatgcccgtgtatactttcaataatcctcatgtattgcaattattcaaggagttacctgcgtgttcatttaatgcagggct |
218 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
42365750 |
tcactttatttgatgattgtatgcccatgtatactttcaataatcctcatgtattgcaattcttcaaggagttacctgtgtgttcatataatgcagggct |
42365651 |
T |
|
| Q |
219 |
accgtgtcatatatgtagatctacctcgtg |
248 |
Q |
| |
|
|||||||||||| ||||||| ||||||||| |
|
|
| T |
42365650 |
accgtgtcatatctgtagatatacctcgtg |
42365621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University