View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_312 (Length: 248)
Name: NF9839A_low_312
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_312 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 7 - 246
Target Start/End: Original strand, 14295911 - 14296150
Alignment:
| Q |
7 |
tttggtgttggatcatgtagtcaagtgtcgcgaaaattgccttccacatctttgctcggtgaaaccgttttatatggtagagatgttgacagagatatta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14295911 |
tttggtgttggatcatgtagtcaagtgtcgcgaaaattgccttccacatctttgctcggtgaaaccgttttatatggtagagatgttgacaaagatatta |
14296010 |
T |
|
| Q |
107 |
tattgaattggttgatatctcatactgacaatgaaaaacaattttctatagtttctattgttggtatgggtgggttgggtaagaccttgcttgctcaaca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14296011 |
tattgaattggttgatatctcatactgacaatgaaaaacaattttctatagtttctattgttggtatgggtgggttgggtaagaccttgcttgctcaaca |
14296110 |
T |
|
| Q |
207 |
cttatataatgactcaaagatggtggatgaatttgatgtc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14296111 |
cttatataatgactcaaagatggtggatgaatttgatgtc |
14296150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University