View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_315 (Length: 247)
Name: NF9839A_low_315
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_315 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 13 - 233
Target Start/End: Complemental strand, 10619883 - 10619659
Alignment:
| Q |
13 |
tggacatcacaactgtaa----gaccatatcgattgcaaattagatctgcgcattttgctttcgtatacaggttcatagtcattgctgcattgtaacttc |
108 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10619883 |
tggacatcacaactgtaattgcgaccatatcgattgcaaattagatctgcgcattttgctttcgtatacaggttcatagtcattgctgcattgtaacttc |
10619784 |
T |
|
| Q |
109 |
tgatagaaggcatgtgcgttgtgacagaaaacaatgtttgacattgacccacgtgattacattaaatttattcatattttaaaatcgacgttgacttgtc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10619783 |
tgatagaaggcatgtgcgttgtgacagaaaacaatgtttgacattgacccacgtgattacattaaatttattcatattttaaaatcgacgttgacttgtc |
10619684 |
T |
|
| Q |
209 |
aatgttattgtcgtgtatgatgtcc |
233 |
Q |
| |
|
|||||||||||| |||||| ||||| |
|
|
| T |
10619683 |
aatgttattgtcatgtatggtgtcc |
10619659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University