View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_321 (Length: 247)
Name: NF9839A_low_321
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_321 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 81 - 218
Target Start/End: Complemental strand, 1971988 - 1971850
Alignment:
| Q |
81 |
accaaagagataacatatcaggttggagttgcagtcaaacattgaaacaacttcaaaacagacttgaatgaatctcatgcacccatacaat-ttttgaaa |
179 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||| ||||||||||| |||||||||||||||||||||||||| |||||||||||| |||| ||| |
|
|
| T |
1971988 |
accaaagagataacatatcaggttggtgttgcattcaaatattgaaacaacctcaaaacagacttgaatgaatctcattcacccatacaattttttaaaa |
1971889 |
T |
|
| Q |
180 |
aagccctagcaatcaaatgcccctaatttgcttgaacca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1971888 |
aagccctagcaatcaaatgcccctaatttgcttgaacca |
1971850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 80 - 218
Target Start/End: Complemental strand, 19962965 - 19962826
Alignment:
| Q |
80 |
taccaaagagataacatatcaggttggagttgcagtcaaacattgaaacaacttcaaaacagacttgaatgaatctcatgcacccatacaat-ttttgaa |
178 |
Q |
| |
|
||||||||||||||| ||| ||| ||||||| |||||| ||||||||| | |||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19962965 |
taccaaagagataacgtattgtgttagagttgcggtcaaatattgaaacagcgtcaacacagacttgaatgaatctcatgcacccatacaattttttgaa |
19962866 |
T |
|
| Q |
179 |
aaagccctagcaatcaaatgcccctaatttgcttgaacca |
218 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19962865 |
aaagccctagcaatcaaattcccctaatttgcttgaacca |
19962826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University