View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_326 (Length: 246)
Name: NF9839A_low_326
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_326 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 24 - 246
Target Start/End: Complemental strand, 31762914 - 31762692
Alignment:
| Q |
24 |
tatgcatcaagctacatcacaaaccttaaacaaattattttaaggtataacataacattgttgattgtcatgtactcaccgataactcagcaagcatgga |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31762914 |
tatgcatcaagctacatcacaaaccttaaacaaattattttaaggtataacataacattgttgattgtcatgtactcaccaataactcagcaagcatgga |
31762815 |
T |
|
| Q |
124 |
aggcagtgttgagttggtttggtttcttctatcaaatattttctcagattattggatcattcgcggataattatcctttactttctctgtcttccaattc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31762814 |
aggcagtgttgagttggtttggtttcttctatcaaatattttctcagattattggatcattcgcggataattatcctttactttctttgtcttccaattc |
31762715 |
T |
|
| Q |
224 |
ttccttcgaatctctatcatctt |
246 |
Q |
| |
|
||||||| || |||||||||||| |
|
|
| T |
31762714 |
ttccttcaaacctctatcatctt |
31762692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University