View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_328 (Length: 246)
Name: NF9839A_low_328
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_328 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 8 - 243
Target Start/End: Complemental strand, 4604006 - 4603771
Alignment:
| Q |
8 |
acatcagtaagtcctcataaacaggagaatgcaacacgagaaaatcaaacagcaaggcaccatgtgctccatctcttcaaccaagatgctccaaccaaca |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
4604006 |
acatcagcaagtcctcataaacaggagaatgcaacacgagaaaatcaaacagcaaggcgccatgagctccatgtctgcaaccaagatgctccaaccaaca |
4603907 |
T |
|
| Q |
108 |
aacaacaaaaccagatgcaacaaagacatctatcatcaaatttttgtagccaaaatccaaaaacatcttcatcagcagagaaaaagcaccacagtgataa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4603906 |
aacaacaaaaccagatgcaacaaagacatctatcatcaaatttttgtagccaaaatccaaaaacatcttcatcagcagagaaaaagcaccacagtgataa |
4603807 |
T |
|
| Q |
208 |
tgaaggctactcaacaacaaaatcagacaccaaact |
243 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||| |
|
|
| T |
4603806 |
tgaaggctactcaacaacaaaaacaaacaccaaact |
4603771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University