View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_331 (Length: 245)
Name: NF9839A_low_331
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_331 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 8 - 230
Target Start/End: Complemental strand, 22205845 - 22205623
Alignment:
| Q |
8 |
ggctggtctattatcaaaaacctttgttctgatacaggtttgtctgtgtgccttgcatctgcagtgaaattcttttaattttttgcatgcttcccttttg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22205845 |
ggctggtctattatcaaaaacctttgttctgatacaggtttgtctctgtgccttgcttctgcagtgaaattcttttaattttttgcatgcttcccttttg |
22205746 |
T |
 |
| Q |
108 |
ttttatgtaataagttatgtttatattgaattcttgtcttaagactggtttgttattgtagggaattgggatatttcattacaaagaactgtccatgtct |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
22205745 |
ttttatgtaataagttatgtttatattgaattcttgtcttaagactggtttgttattgttgggaattgggaaatttcattacaaagaactgtccatgtct |
22205646 |
T |
 |
| Q |
208 |
agctgtctgtcatgcaactattt |
230 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
22205645 |
agctgtctgtcatgcaaccattt |
22205623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University