View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_336 (Length: 245)
Name: NF9839A_low_336
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_336 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 15 - 235
Target Start/End: Original strand, 4607846 - 4608062
Alignment:
| Q |
15 |
atatactcaaatgggtttttgaaatgaaactatactcaatgagttttttgaactagaagaaaactctttctaactagctagctcacgggtttctttgttt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4607846 |
atatactcaaatgggtttttgaaatgaaactatactcaatgagttttttgaactagaagaaaactctttctaactag----ctcacgggtttctttgttt |
4607941 |
T |
|
| Q |
115 |
tttagtgggtatctttcatacgtaatagtacacattgttccagaaagttttccaattgttgttggaaccatttgacagtgattttttagattgttattgg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4607942 |
tttagtgggtatctttcatacgtaatagtacacattgttccagaaagttttccaattgttgttggaaccatttgccagtgattttttagattgttattgg |
4608041 |
T |
|
| Q |
215 |
gtgagttgaaagtactttttg |
235 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4608042 |
gtgagttgaaagtactttttg |
4608062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University