View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_343 (Length: 244)
Name: NF9839A_low_343
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_343 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 12 - 244
Target Start/End: Original strand, 4365751 - 4365983
Alignment:
| Q |
12 |
acatcatgcaattggtcccgtctaaaaatattgttccaagaatttatgaaaaatcacacactgaacatgttttatgcagtagttttcatgctttctctag |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
4365751 |
acatgatgcaattggtcccgtctaaaaatattgttccaagaatttatgaaaaatcacacactgaacatgttttgtgcagtagttttcaggctttctctag |
4365850 |
T |
|
| Q |
112 |
ttcatctaaataagtatctttctttctttttaagcatgtacaaagttcatatccggaaccaaacttcaagttcatctccgtaatgatttatttcagttat |
211 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4365851 |
ttcatctaaacaagtatctttctttctttttaagcatgtacaaagttcatatccggaaccaaacttcaagttcatatccgtaatgatttatttcagttat |
4365950 |
T |
|
| Q |
212 |
aaactaactcatacccatcaaactcaattaaaa |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4365951 |
aaactaactcatacccatcaaactcaattaaaa |
4365983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University