View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_356 (Length: 242)
Name: NF9839A_low_356
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_356 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 5 - 242
Target Start/End: Complemental strand, 25146339 - 25146102
Alignment:
| Q |
5 |
agatggacatcatcatcaactctcttattagggcaaacagttattctaattatacaaaacctataataagaaactaggcaccaaaggtgattggtaggtt |
104 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25146339 |
agatgaacatcatcatcaactctcttattagggcaaacagttattctaattatacaaaacctataataagaaactaggcaccaaaggtgattggtaggtt |
25146240 |
T |
 |
| Q |
105 |
gcttcagccagctgactccaagaaaggttccaggtttggttgctgaattccgaggtagtggatgatcccagttcaaaacctgtaggaaaaacattctcat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25146239 |
gcttcagccagctgactccaagaaaggttccaggtttggttgctgaattccgaggtagtggatgatcccagttcaaaacctgtaggaaaaacattctcat |
25146140 |
T |
 |
| Q |
205 |
ttgagacctttttctttttcgctgttcgctgttcttcg |
242 |
Q |
| |
|
||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
25146139 |
ttgtgacctttttctttttcgctgttcgatgttcttcg |
25146102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University