View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9839A_low_359 (Length: 242)

Name: NF9839A_low_359
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9839A_low_359
NF9839A_low_359
[»] chr1 (1 HSPs)
chr1 (100-237)||(17525941-17526079)


Alignment Details
Target: chr1 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 100 - 237
Target Start/End: Complemental strand, 17526079 - 17525941
Alignment:
100 caaaattctccaaatatgtcacgaaattttagtatttctaagccagttatttttt-gtaattttaatctttccacgaaaacacgaatttaaactataaat 198  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |||    
17526079 caaaattctccaaatatgtcacgaaattttaatatttctaagccagttatttttttgtaattttaatctttccacgaaaacccgaatttaaactattaat 17525980  T
199 agaagttagaaacttcgatacttgccaggaacaccaaac 237  Q
    ||||||||||||||||||||||||||||||||| |||||    
17525979 agaagttagaaacttcgatacttgccaggaacatcaaac 17525941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University