View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_359 (Length: 242)
Name: NF9839A_low_359
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_359 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 100 - 237
Target Start/End: Complemental strand, 17526079 - 17525941
Alignment:
| Q |
100 |
caaaattctccaaatatgtcacgaaattttagtatttctaagccagttatttttt-gtaattttaatctttccacgaaaacacgaatttaaactataaat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| ||| |
|
|
| T |
17526079 |
caaaattctccaaatatgtcacgaaattttaatatttctaagccagttatttttttgtaattttaatctttccacgaaaacccgaatttaaactattaat |
17525980 |
T |
|
| Q |
199 |
agaagttagaaacttcgatacttgccaggaacaccaaac |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
17525979 |
agaagttagaaacttcgatacttgccaggaacatcaaac |
17525941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University