View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_364 (Length: 241)
Name: NF9839A_low_364
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_364 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 38 - 198
Target Start/End: Complemental strand, 12122326 - 12122166
Alignment:
| Q |
38 |
agattggttctcgaacatggcaacctcaatcctccgaagattacattcggaaatgcctccagaaagatcgagaatcttctacgataaaattagggtttag |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12122326 |
agattggttctcgaacatggcaacctcaatcctccgaagattatattcggaaatgcctccagaaagatcgagaatcttctacgataaaattagggtttag |
12122227 |
T |
|
| Q |
138 |
aatctctgggttgaggtctgtgggtcccagtaacaaattatggcagcctcatagaaagctt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12122226 |
aatctctgggttgaggtctgtgggtcccagtaacaaattatggcagcctcatagaaagctt |
12122166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 38 - 195
Target Start/End: Complemental strand, 14691845 - 14691688
Alignment:
| Q |
38 |
agattggttctcgaacatggcaacctcaatcctccgaagattacattcggaaatgcctccagaaagatcgagaatcttctacgataaaattagggtttag |
137 |
Q |
| |
|
|||| ||||| ||||||||||| || || ||||| ||||||||||| |||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
14691845 |
agatcggttcacgaacatggcacccacagtcctctgaagattacatccggaaatgcctccagaaagatcgagaatcttctagtatcaaattagggtttag |
14691746 |
T |
|
| Q |
138 |
aatctctgggttgaggtctgtgggtcccagtaacaaattatggcagcctcatagaaag |
195 |
Q |
| |
|
|||||| || |||||||| |||||||||| ||| |||||||||||||||||| |||| |
|
|
| T |
14691745 |
aatctccggtttgaggtcagtgggtcccactaatcaattatggcagcctcataaaaag |
14691688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University