View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_374 (Length: 239)
Name: NF9839A_low_374
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_374 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 35 - 167
Target Start/End: Complemental strand, 9159098 - 9158966
Alignment:
| Q |
35 |
ctttctttcctatcggttacggttctatcgtctcggtcatctcattttatggtttcagcatatggctatggttcagatacagactaaatactttccttcg |
134 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9159098 |
ctttctttcctatcgattacggttctatcgtctcggtcatctcattttatggtttcagcatatagctatggttcagatacagactaaatactttctttcg |
9158999 |
T |
|
| Q |
135 |
tgctttgatctcagctggtggaagtagagtggc |
167 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| |
|
|
| T |
9158998 |
tgttttgatctcagctggtggaagtagagtggc |
9158966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 10 - 40
Target Start/End: Complemental strand, 9171691 - 9171661
Alignment:
| Q |
10 |
ctggtatgtctttcttttgcgccagctttct |
40 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9171691 |
ctggtatgtctttcttttgcgccagctttct |
9171661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 125 - 226
Target Start/End: Original strand, 50431444 - 50431546
Alignment:
| Q |
125 |
ctttccttcgtgctttgatctcagctggtggaagtagagtggctatt-gctcctgaccattcaaagtagtcattcttggaaaacaatgcctggcatgctc |
223 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
50431444 |
ctttctttcgtgctttgatcttagctggtggaagtagagtggctatttgctcctgaccattcaaagtagtcattcttgaaaaacaatgcatggcatgctc |
50431543 |
T |
|
| Q |
224 |
tgc |
226 |
Q |
| |
|
||| |
|
|
| T |
50431544 |
tgc |
50431546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University