View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_381 (Length: 238)
Name: NF9839A_low_381
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_381 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 13 - 197
Target Start/End: Original strand, 33817437 - 33817621
Alignment:
| Q |
13 |
atactagtggtatttactcgaataacttgacttattggactttcccggcaaatctacctttctcgatggatcaactccaaatcatttctaaggtttggaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33817437 |
atactagtggtatttactcgaataacttgacttattggactctctcggcaaatctatctttctcgatggatcaactccaaatcatttctaaggtttggaa |
33817536 |
T |
 |
| Q |
113 |
gagtgttaatccggaaaaagatatcgcattttcttggaaactgctcctcgacaaggtcccgactcatcaaagtcttatgttgtcc |
197 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33817537 |
gagtgttaatccggaaaaagttatcgcattttcttgaaaactgctcctcgacaaggccccgactcatcaaagtcttatgttgtcc |
33817621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University