View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_385 (Length: 235)
Name: NF9839A_low_385
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_385 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 16 - 216
Target Start/End: Original strand, 17807913 - 17808114
Alignment:
| Q |
16 |
acatcacacgtttaaattttctctccatttttccggtatatcctagaacaatcaaacatgacacaaagctaaacatggccgcaagagctgactaaatgga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17807913 |
acatcacacgtttaaattttctctccatttttccggtatatcctagaacaatcaaacatgacacaaagcttaacatggccgcaagagctgactaaatgga |
17808012 |
T |
|
| Q |
116 |
aacatgcctcagaagcatgagcctgaggacatgaagcacatcttgactcaaacactacataaccaaatcctcattgagttttatttctg-tttgagtata |
214 |
Q |
| |
|
|| || |||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17808013 |
gacctgtctcagaagcatgagcccgaggacatgaagcacatcttgactcaaacactaaataaccaaatcctcattgagttttatttctgttttgagtata |
17808112 |
T |
|
| Q |
215 |
at |
216 |
Q |
| |
|
|| |
|
|
| T |
17808113 |
at |
17808114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University