View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_397 (Length: 231)
Name: NF9839A_low_397
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_397 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 217
Target Start/End: Original strand, 32780922 - 32781123
Alignment:
| Q |
16 |
tgtgcagaatcatagacggattattattagtttatggcgaagtcgaggcaaaaatcatcgaaccaggattcttcattatcgccgactgcggcaagatcaa |
115 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32780922 |
tgtgcagagccagagacggattattattagtttatggcgaagtcgaggcaaaaatcatcgaaccaggattcttcattatcgccgactgcggcaagatcaa |
32781021 |
T |
|
| Q |
116 |
gggaatgggatggtccatctagatgggcagactaccttggaacagaaacgaatacggcttctccattgtcgtcaaccagctccaggaatttcggtcatga |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32781022 |
gggaatgggatggtccatctagatgggcagactaccttggaacagaaacaaatacggcttctccattgtcgtcaaccagctccaggaatttcggtcatga |
32781121 |
T |
|
| Q |
216 |
tg |
217 |
Q |
| |
|
|| |
|
|
| T |
32781122 |
tg |
32781123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University