View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_411 (Length: 230)
Name: NF9839A_low_411
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_411 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 13 - 119
Target Start/End: Complemental strand, 10360662 - 10360557
Alignment:
| Q |
13 |
ggacatcacattacacatggaggatagtcatagatattttatggaatgaatcaatgaagactcagacaaaggcaagggtttcttttatgtaaaaagttgt |
112 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||| ||||||||| |
|
|
| T |
10360662 |
ggacaacacattacacatggaggatattcatagatattttatggaatgaatcaatgaagactcagataaaggcaagggttttttttatgt-aaaagttgt |
10360564 |
T |
|
| Q |
113 |
tgggtgc |
119 |
Q |
| |
|
||||||| |
|
|
| T |
10360563 |
tgggtgc |
10360557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University