View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_417 (Length: 230)
Name: NF9839A_low_417
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_417 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 40852677 - 40852448
Alignment:
| Q |
1 |
taaactatatatataactaaataggaagaaaaatatatcaaaagtaagtgctcataaaagcatatattcagttataggtctgcttcagtgtatgttgtta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40852677 |
taaactatatatataactaaataggaagaaaaataaatcaaaagtaagtgctcataaaagcatatattcagttataggtctgcttcagtgtatgttgtta |
40852578 |
T |
|
| Q |
101 |
gttttgagtattgagcactcaattatgatgaaagtgctagttcagcccaagctaaagatgatgacttgagctccacacttatcgatgtgtcgattctgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40852577 |
gttttgagtattgagcactcaattatgatgaaagtgctagttcagcccaagctaaagatgatgacttgagctccacacttatcgatgtgtcgattctgct |
40852478 |
T |
|
| Q |
201 |
ttcgagcatgctgcacaactcttgcattga |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40852477 |
ttcgagcatgctgcacaactcttgcattga |
40852448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 227
Target Start/End: Original strand, 2791823 - 2791890
Alignment:
| Q |
160 |
gatgacttgagctccacacttatcgatgtgtcgattctgctttcgagcatgctgcacaactcttgcat |
227 |
Q |
| |
|
||||||||||| ||| | |||| ||||||||||||||||| || |||||||||||||| |||||||| |
|
|
| T |
2791823 |
gatgacttgagatccgcgcttactgatgtgtcgattctgctctccagcatgctgcacaattcttgcat |
2791890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University