View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_423 (Length: 230)
Name: NF9839A_low_423
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_423 |
 | |
|
| [»] scaffold0177 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 99 - 213
Target Start/End: Original strand, 51507456 - 51507576
Alignment:
| Q |
99 |
atacctggaccacaacacagtgaagaagaagcaaactcgaaaatcaaacttgaactgtggatacgaaa------tcgaactcaaactcagggaacaacaa |
192 |
Q |
| |
|
|||| ||||||||||||| ||||| |||||||||||||||||||||||||||||| ||| |||||||| |||||||| ||||||||||||||||| |
|
|
| T |
51507456 |
atacatggaccacaacacggtgaacaagaagcaaactcgaaaatcaaacttgaacggtgaatacgaaatcgaactcgaactcgaactcagggaacaacaa |
51507555 |
T |
|
| Q |
193 |
tctcgaaatcagaattgaact |
213 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
51507556 |
tcttgaaatcagaattgaact |
51507576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0177 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0177
Description:
Target: scaffold0177; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 167 - 214
Target Start/End: Original strand, 24692 - 24739
Alignment:
| Q |
167 |
tcgaactcaaactcagggaacaacaatctcgaaatcagaattgaactc |
214 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
24692 |
tcgaactcgaactcagggaacaacaatctttaaatcataattgaactc |
24739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University