View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_429 (Length: 229)
Name: NF9839A_low_429
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_429 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 35621835 - 35622072
Alignment:
| Q |
1 |
aataatgaactaattcatttgagcacatgtcaaaacaaagtattaatatgttacatttatagggaacaaaagggctctcaaatatgatgttcttatatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35621835 |
aataatgaactaattcatttgagcacatgtcaaaacaaagtattaatatgttacatttatagggaacaaaagggctctcaaatatgatgttcttatatat |
35621934 |
T |
|
| Q |
101 |
-gtttcatattattggtacatttgcttcgaagggtggtgaaaagtattaccagtgag--------nnnnnnnnnnngaaacatattactagtgtgttatg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
35621935 |
ggtttcatattattggtacatttgcttcgaagggtggtgaaaagtattactagtgagtttttttttttttttttttgaaacatattactagtgtgttata |
35622034 |
T |
|
| Q |
192 |
atccaagcaaaaactttaatttctcatctcaaatatga |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35622035 |
atccaagcaaaaactttaatttctcatcttaaatatga |
35622072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University