View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_437 (Length: 229)
Name: NF9839A_low_437
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_437 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 3 - 221
Target Start/End: Complemental strand, 6039419 - 6039201
Alignment:
| Q |
3 |
ttgattggagacagcaaatgatggattagagaaagaatgcagaggactggatggttgattgtgcactaagacaagtagttaacaagcttgctcctgctcg |
102 |
Q |
| |
|
|||||| ||| || |||||||||||| | ||||||||||||||||| ||||||||||||||||||||||| |||| || |||||||||||||||||| | |
|
|
| T |
6039419 |
ttgatttgaggcatcaaatgatggatgaaagaaagaatgcagaggattggatggttgattgtgcactaaggcaagctgtgaacaagcttgctcctgctag |
6039320 |
T |
|
| Q |
103 |
gaagaagaaagtggcgttgctagttgaagcctttgaaactgtaataccaaaatgtgagtcacatctgagaaacaaatcagggtttgctcatggtagacac |
202 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| ||||||| |||||| |
|
|
| T |
6039319 |
aaagaagaaagtggcattgctagttgaagcctttgaaactgtaataccaaaatgtgagtcacatttgagaaacagatcagggttttctcatggaagacac |
6039220 |
T |
|
| Q |
203 |
attcaagcttgtagctgat |
221 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
6039219 |
attcaagcttgtagctgat |
6039201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University