View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_438 (Length: 229)
Name: NF9839A_low_438
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_438 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 44904818 - 44905046
Alignment:
| Q |
1 |
ttagaaattccgccttaatctcaatctgcccctatttgttatgccttcattgcgggttattgttccttcatcgtgtttataaaaaatggctcaccactca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
44904818 |
ttagaaattccgccttaatctcaatctgcccctatttgtgatgccttcattgcggtctcttgtaccttcatcgtgtttataaaaaatggctcaccactca |
44904917 |
T |
 |
| Q |
101 |
gcttgcatctgatgcaaaagtggctgtgaagtgtgaagtgcttaaatggtaaatgtgacctagcaaccattggtccaatacttctagattgtttaagtta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44904918 |
gcttgcatctgatgcaaaagtggctgtgaagtgtgaagtgcttaaatggtaaatgtgacctagcaaccattggtccaatacttctagattgtttaagtta |
44905017 |
T |
 |
| Q |
201 |
gagtaaatgctgatatcaaatgaaactga |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44905018 |
gagtaaatgctgatatcaaatgaaactga |
44905046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University