View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_445 (Length: 228)
Name: NF9839A_low_445
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_445 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 32 - 175
Target Start/End: Original strand, 31731606 - 31731749
Alignment:
| Q |
32 |
catagaagaatagcgattaacatgccgtcagtgcacttccaatcaatgttacacccctgaatcatcactctaaggtaacttctgtatttggattagtaat |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31731606 |
catagaagaatagcgattaacatgccgtcagtgcacttccaatcaatgttacacccctgaatcatcactctagggtaacttctgtatttggattagtaat |
31731705 |
T |
|
| Q |
132 |
ttgagctccaaagccagatgcaaggaactttctgtaatgatgtc |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31731706 |
ttgagctccaaagccagatgcaaggaactttctgtaatggtgtc |
31731749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 48 - 141
Target Start/End: Complemental strand, 45259640 - 45259547
Alignment:
| Q |
48 |
ttaacatgccgtcagtgcacttccaatcaatgttacacccctgaatcatcactctaaggtaacttctgtatttggattagtaatttgagctcca |
141 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
45259640 |
ttaacatgccgtcggtacacttccaatcaatgttacacccctgaatcatcactctagggtgacttctgtatttggattagtaatttgagctcca |
45259547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 139 - 175
Target Start/End: Complemental strand, 45259517 - 45259481
Alignment:
| Q |
139 |
ccaaagccagatgcaaggaactttctgtaatgatgtc |
175 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
45259517 |
ccaaagcccgatgcaaggaactttctgtaatggtgtc |
45259481 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 90
Target Start/End: Original strand, 47868806 - 47868848
Alignment:
| Q |
48 |
ttaacatgccgtcagtgcacttccaatcaatgttacacccctg |
90 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||| ||||| |
|
|
| T |
47868806 |
ttaacatgccgtcagtacacttccaatcaatgtcacatccctg |
47868848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University