View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_454 (Length: 227)
Name: NF9839A_low_454
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_454 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 35559175 - 35558972
Alignment:
| Q |
1 |
ggtaaggggaaaaccttgcctcgtgtaacgaatcgtgatgacgagattaatgacacgataccgagtttgggatcggagactaatttcaggaatgggaagt |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35559175 |
ggtaaggggaaaaccttgcctcgggtaacgaatcgtgatgacgagattaatgacacgataccgagtttgggatcggagactaatttcaggaatgggaagt |
35559076 |
T |
|
| Q |
101 |
atttgtattattcgcgaggtggtgattattgtaagggtatgaatcattttatgtggagttttttgtgtggtttaggtgaagctatgtttttgaatagaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35559075 |
atttgtattattcgcgaggtggtgattattgtaagggtatgaatcattttatgtggagttttttgtgtggtttaggtgaagctatgtttttgaatagaac |
35558976 |
T |
|
| Q |
201 |
tttt |
204 |
Q |
| |
|
|||| |
|
|
| T |
35558975 |
tttt |
35558972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University