View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_459 (Length: 226)
Name: NF9839A_low_459
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_459 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 12274500 - 12274725
Alignment:
| Q |
1 |
gtatgagccccaagttgaggagaagagatcaagtattcgcgagttagtatttatagtatatctttaaggtttcgcttctttaacctttacttggacagct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
12274500 |
gtatgagccccaagttgaggagaagagatcaagtattcgcgagttagtatttatagtatatctttaaagtttcgcttcttcaacctttacttggacagct |
12274599 |
T |
|
| Q |
101 |
gtcctttaaagataattgtagtccttaatggaagcttgtgaacagattatgaaaaattacctcaaatccgaaccagaaggtccatatcatttccaggggt |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||| || |||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
12274600 |
gtcctttaaagacaattgtagtccttaagggacgcctgtgaatagattatgaaaaattacctcaaatccgaactagaaggtccatatcatttccaggggt |
12274699 |
T |
|
| Q |
201 |
cacagttcccgtgcggtcctacgtga |
226 |
Q |
| |
|
||||||||||||||| |||||||||| |
|
|
| T |
12274700 |
cacagttcccgtgcgatcctacgtga |
12274725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University