View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_471 (Length: 224)
Name: NF9839A_low_471
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_471 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 5 - 220
Target Start/End: Original strand, 51960933 - 51961148
Alignment:
| Q |
5 |
actacactgttgcatgtcaccagaaattgacacttaaacaagaagttgaaggtttttgctcagagtgaagaatcttcttcggtgtatatgacgaaattat |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51960933 |
actacactgttgcatgtcaccagaaattgacacttaaacaagaagttgaaggtttttgctcaaagtgaagaatcttcttcggtgtatatgacgaaattat |
51961032 |
T |
|
| Q |
105 |
gtgtctaatagatttagactttgagacaaaagagtagaatctgcttccgtgatctaggagaggatggaaagctacacctttaatttaagcagagtctttc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
51961033 |
gtgtctaatagatttagactttgagacaaaagagtagaatctgcttccgtgatctaggagaggatggaaagctacacctttaatttaaccagagtctttc |
51961132 |
T |
|
| Q |
205 |
ttattgacagaacaac |
220 |
Q |
| |
|
||||||| ||| |||| |
|
|
| T |
51961133 |
ttattgatagagcaac |
51961148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University