View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_473 (Length: 224)
Name: NF9839A_low_473
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_473 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 33762778 - 33762555
Alignment:
| Q |
1 |
acaaatgatactaaagggtcacaattggatccttcggagtcaacatttttagggttggatgataataggctatgtcaatgggatatgcgtgatagaaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33762778 |
acaaatgatactaaagggtcacaattggatccttcggagtcaacatttttagggttggatgataataggctatgtcaatgggatatgcgtgatagaaaag |
33762679 |
T |
|
| Q |
101 |
ggattgttcagaatatagcaacagcgaattctccggttttgcattggaaccaggggcatcaattttcaagagggacaaattttaaatgctttgcaactac |
200 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33762678 |
gaattgttcagaatatagcaacagcgaattctccggttttgcattggaaccaggggcatcaattttcaagagggacaaattttcaatgctttgcaactac |
33762579 |
T |
|
| Q |
201 |
aggagatggttcaattgtggtggg |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
33762578 |
aggagatggttcaattgtggtggg |
33762555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 89
Target Start/End: Complemental strand, 46813513 - 46813428
Alignment:
| Q |
4 |
aatgatactaaagggtcacaattggatccttcggagtcaacatttttagggttggatgataataggctatgtcaatgggatatgcg |
89 |
Q |
| |
|
||||||| ||||||| | ||||||||||| |||| ||||| ||| | || ||||||||||||||||| ||| ||||||||||| |
|
|
| T |
46813513 |
aatgatagtaaaggggctcaattggatccatcgggttcaacttttcttggattggatgataataggctttgtaggtgggatatgcg |
46813428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University