View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_477 (Length: 223)
Name: NF9839A_low_477
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_477 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 6759738 - 6759618
Alignment:
| Q |
1 |
aatatcatagatacagagatggtcaattactcatccatccagcccaaccgaaaattttcacctcagtataacatgctttcacaaatgcaaacttcaattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6759738 |
aatatcatagatacagagatggtcaattactcatccatccagcccaaccgaaaattttcaactcagtataccatgctttcacaaatgcaaacttcaattt |
6759639 |
T |
|
| Q |
101 |
atgatagatgcacgacccgta |
121 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
6759638 |
atgatagatgcacgacccgta |
6759618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 120 - 223
Target Start/End: Complemental strand, 6759575 - 6759472
Alignment:
| Q |
120 |
taaatccagccatgtttagttacttatacattgagccgaaattgaaatttttcactatgtatactttgttgtcacaatgttaagcgactatgatatctgc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6759575 |
taaatccagccatgtttagttacttatacattgagccgaacttgaaaattttcactatgtatactttgttgtcacaatgttaagcgactatgaaatctgc |
6759476 |
T |
|
| Q |
220 |
agca |
223 |
Q |
| |
|
|||| |
|
|
| T |
6759475 |
agca |
6759472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University