View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_478 (Length: 222)
Name: NF9839A_low_478
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_478 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 34092828 - 34093047
Alignment:
| Q |
1 |
tgattaggacttttctcaatgagaaactttgccaaagtcagattgatattgaataattggctaaacaaatctcacattatatatacacaaccacttgaaa |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34092828 |
tgattaggacttttctcaataagaaactttgccaaagtcagattgatattgaataattggcaaaacaaatctcacattatatatacacaaccacttgaaa |
34092927 |
T |
 |
| Q |
101 |
taaaagaaacaattacattgtatgcaaatcattatcgttggctattagagcatatattaattcaaagatgaaaaagacattggtagctagaaaaatgaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34092928 |
taaaagaaacaattacattgtatgcaaatcattatcgttggctattagagcatatattaattcaaagatgaaaaagacattggtagctagaaaaatgaag |
34093027 |
T |
 |
| Q |
201 |
aagaggcattaggttaggta |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
34093028 |
aagaggcattaggttaggta |
34093047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University