View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_480 (Length: 222)
Name: NF9839A_low_480
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_480 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 22 - 209
Target Start/End: Complemental strand, 28519844 - 28519649
Alignment:
| Q |
22 |
gaaacatagattgtgggcaaatcttatgttgattaaaaacacttttggtgatggtgt-------atggttggggatttcaatgcggtgagccatgcagat |
114 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |
|
|
| T |
28519844 |
gaaacaaagattgtgggcaaatcttgtgttgattaaaaacacttttggtgatggtgtgtggtgtatggttggggatttcaatgcggtgagccatgcggat |
28519745 |
T |
|
| Q |
115 |
gaaaggagggggg-tcaattcggttgtttcatcggcacaatctttggaaacatatttcttcaattcttttgttttgaatgttgatttatttgatgt |
209 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28519744 |
gaaagaagggggggtcaattcggttgtttcatcggcacaatctttggaaacatatttcttcaattcttttgttttgaatgttgatttatttgatgt |
28519649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University