View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_488 (Length: 221)
Name: NF9839A_low_488
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_488 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 20 - 194
Target Start/End: Complemental strand, 6992765 - 6992599
Alignment:
| Q |
20 |
tgaaatagagtgtatctagttaccgttaccatggttcaatagattaagctatgtagttgtgtgtaaaatgcatcgactaaaaataaaaacggagaaaagt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||| |||||||||||| |||||| ||||| ||| |
|
|
| T |
6992765 |
tgaaatagagtgtatctagttaccgttaccatcgtttaatagattaagctatgtagttgtgtgcaaaatgcatcgattaaaaagaaaaa--------agt |
6992674 |
T |
|
| Q |
120 |
ttaataaagagacagtttaacggaatatccaaattccaattacgacttggtccaactccaatcaaaagaatctaa |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6992673 |
ttaataaagagacagtttaacggaatatccaaattccaattacgacttggtccaactccaatcaaaagaatctaa |
6992599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University