View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_492 (Length: 220)
Name: NF9839A_low_492
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_492 |
 | |
|
| [»] scaffold0066 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0066 (Bit Score: 115; Significance: 1e-58; HSPs: 3)
Name: scaffold0066
Description:
Target: scaffold0066; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 25 - 168
Target Start/End: Original strand, 33512 - 33657
Alignment:
| Q |
25 |
aaaggaaggtgtaagatgggaaaat--gaaaagaagtaatagaattgtccaaattctgatactctttgggttttggggagccattgaaggctgaggtgca |
122 |
Q |
| |
|
||||| ||||| ||| ||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33512 |
aaagggaggtgaaaggtgggaaaatatgaaaagaagtcatagaattgtccaaattctgatactctttgggttttggggagccattgaaggctgaggtgca |
33611 |
T |
|
| Q |
123 |
tgccgtgatgtctaaaagtctccgaatatgcgtcacagctacctct |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33612 |
tgccgtgatgtctaaaagtctccgaatatgcgtcacagccacctct |
33657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 86 - 198
Target Start/End: Original strand, 31218 - 31330
Alignment:
| Q |
86 |
ctttgggttttggggagccattgaaggctgaggtgcatgccgtgatgtctaaaagtctccgaatatgcgtcacagctacctcttccgtgtcatactcctc |
185 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||| |
|
|
| T |
31218 |
ctttgggttttggggagccattgaaggttgaggtgcatgccgtgatgtctaaaagtctccgaatatgcgtcaccgccacctcttccgtgttgtactcctc |
31317 |
T |
|
| Q |
186 |
tgaaaaataacaa |
198 |
Q |
| |
|
||||||||||||| |
|
|
| T |
31318 |
tgaaaaataacaa |
31330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0066; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 25 - 74
Target Start/End: Original strand, 31108 - 31157
Alignment:
| Q |
25 |
aaaggaaggtgtaagatgggaaaatgaaaagaagtaatagaattgtccaa |
74 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
31108 |
aaagggaggtgtaaggtgggaaaatgaaaagaagtcatagaattgtccaa |
31157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University