View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_50 (Length: 408)
Name: NF9839A_low_50
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_50 |
 | |
|
| [»] scaffold0027 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0027 (Bit Score: 337; Significance: 0; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 337; E-Value: 0
Query Start/End: Original strand, 17 - 393
Target Start/End: Complemental strand, 120508 - 120132
Alignment:
| Q |
17 |
acatcacttgaaaatgtcgttcaccaccattgcaaacggtgttccttccaactccacggtggcgatgatgttgggccggcgaagaattccaatccacaca |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
120508 |
acatcacttgaaaatgtcattcaccaccactgcaaacggtgttccttccaactccacggtggcgatgatgttgggccggcgaagaattccaatccacaca |
120409 |
T |
|
| Q |
117 |
tcattctattggggtcataatgtagacatactattccgttgctggcctggggacagcgctgtcatgtacgcagtggcgttgatcctcgtgtttgtaatgt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
120408 |
tcattctattggggtcataatgtagacatactattccattgctggcccggggacagcgctgtcatgtacgcggtggcgctgatcctcgtgtttgtaatgt |
120309 |
T |
|
| Q |
217 |
cgttgctggtgtggtggctttcatttaccaatattgttaaactcaaacctgggacatcaaacgacgtcgttggctcacttttaaggacgggcctgtatgg |
316 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
120308 |
cgttgttggtggagtggctttcatttaccaatattgttaaagtcaaacctgggacatcaaacgacgtcgttggctcacttttaaggacgggcctgtatgg |
120209 |
T |
|
| Q |
317 |
tgtccgtactggattctcgtacttggttatgttggctgttatgtcgtttaatggtggtgtgtttctagctgcaattg |
393 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
120208 |
tgtccgtactggattctcgtacttggttatgttggctgttatgtcgtttaatggtggtgtgtttctagctgcaattg |
120132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 339 - 380
Target Start/End: Complemental strand, 24295831 - 24295790
Alignment:
| Q |
339 |
ttggttatgttggctgttatgtcgtttaatggtggtgtgttt |
380 |
Q |
| |
|
||||||||||||||| ||||||| || ||||||||||||||| |
|
|
| T |
24295831 |
ttggttatgttggctcttatgtctttcaatggtggtgtgttt |
24295790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University