View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_504 (Length: 216)
Name: NF9839A_low_504
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_504 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 33790989 - 33790890
Alignment:
| Q |
10 |
atcattgggcattattatatgttagaaagttaaagaaattttgctttaaaaacagtaaataaagaatatagaaaatcttgtgctcattgaaattattagc |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
33790989 |
atcaatgggcattattatatgttagaaatttaaagaaattatgctttaaaaacagtaaataaagaatatggaaaaccttgtgctcattgaaattattagc |
33790890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University