View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9839A_low_509 (Length: 214)
Name: NF9839A_low_509
Description: NF9839A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9839A_low_509 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 15 - 197
Target Start/End: Complemental strand, 33445720 - 33445538
Alignment:
| Q |
15 |
gacatcatctacagggaagaaggccattgttgccccatattctggacacatgtttgcaatcgtagccctatcaggtaacgacagttcaccaacgccttca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33445720 |
gacatcatctacagggaagaaggccattgttgccccatattctggacacatgtttgcaatcgtagccctatcaggtaacgacagttcaccaacgccttca |
33445621 |
T |
 |
| Q |
115 |
ccttaagatatatttaaataggctcactcatttgtgcagatgttgtgaaagttgttcataaactctatcctatgcagtctcat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33445620 |
ccttaagatatatttaaataggctcactcatttgtgcagatgttgtgaaagttgttcttaaactctatcctatgcagtctcat |
33445538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 30 - 144
Target Start/End: Original strand, 40560106 - 40560222
Alignment:
| Q |
30 |
gaagaaggccattgttgccccatattctggacacatgtttgcaatcgtagccctatcaggtaacgacagttcaccaacgccttcaccttaag--atatat |
127 |
Q |
| |
|
||||||| ||||||||| | | |||| | |||||||||||||||| || |||| ||||||||| |||||||| ||||||||||| |||||| |||||| |
|
|
| T |
40560106 |
gaagaagaccattgttgtctcgtattatcaacacatgtttgcaatcctatccctgtcaggtaacaacagttcatcaacgccttcaacttaaggcatatat |
40560205 |
T |
 |
| Q |
128 |
ttaaataggctcactca |
144 |
Q |
| |
|
|||||||| |||||||| |
|
|
| T |
40560206 |
ttaaatagactcactca |
40560222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University